Each batch ships with a batch-specific Certificate of Analysis (CoA) based on independent HPLC testing not self-reported or supplier-provided data
The following shRNA constructs were used (See also Key Resources Table): shGFP, shFOXO4-1: TRCN0000039720, Mature sequence: CCAGCTTCAGTCAGCAGTTAT, shFOXO4-2: TRCN0000039721, Mature sequence: CGTCCACGAAGCAGTTCAAAT, shFOXO4(mouse): TRCN0000071560, Mature sequence: GATCTGGATCTTGATATGTAT, shp53-1: TRCN0000003753, Mature sequence: CGGCGCACAGAGGAAGAGAAT and shp53-2: TRCN0000003754, Mature sequence: TCAGACCTATGGAAACTACTT
Expression of both HGF and MET is first found in the cortical ventricular zone and later in the cortical plate (Powell et al., 2001)
Cities continue to remain places of capital accumulation and unsustainability, creating inequalities within the city as well as beyond the city boundaries
At $1.73 per serving, Wonderfeel is actually priced pretty well compared to the other NAD+ supplements in our test roster, which range from 73 cents a serving to more than $3
